Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-465b-5p 억제를 위한 Tough Decoy(TuD) 디자인 기반 렌티바이러스형 miRNA 억제제. TRC2-pLKO-puro 벡터 사용으로 안정적 발현 및 퓨로마이신 선택 가능. 다양한 세포 유형에 효율적 전달 및 장기 억제 가능.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-465b-5p
Tough Decoy (TuD) 디자인 기반
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UAUUUAGAAUGGUGCUGAUCUG |
| Sanger 성숙/소수 수납 번호 | MIMAT0004871 |
| microRNA 수납 번호 | MI0005498, MI0005499 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNA.
miRNA regulate gene expression via translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 강력하고 선택적인 miRNA 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 전달
- 반복적인 트랜스펙션 없이 장기적인 억제 효과 제공
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.