
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 microRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 설계. 효율적인 세포 전달 및 장기적인 miRNA 억제 가능. puromycin 저항성 유전자 포함으로 선택 용이. −70°C에서 건빙 상태로 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-343
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, enhancing transgene expression delivered by lentiviral vectors.
This vector also carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 기반 전달로 다양한 세포에 효율적 적용
- 반복적인 형질감염 없이 장기적인 억제 가능
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UCUCCCUUCAUGUGCCCAGA |
| Sanger 성숙/소수 수납 번호 | MIMAT0004868 |
| microRNA 수납 번호 | MI0005494 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



