CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

개별 miRNA 억제를 위해 설계된 렌티바이러스 기반 microRNA Inhibitor. Tough Decoy(TuD) 디자인 적용으로 강력한 억제 효과 제공. 다양한 세포주에 효율적 전달 가능하며, 장기 억제 유지. 퓨로마이신 내성 유전자를 포함하여 선택 용이.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD1248 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-5616-3p

Tough Decoy (TuD) Design


제품 정보

항목 내용
Quality Level 200
제품 라인 MISSION®
형태 (Form) Liquid
농도 (Concentration) ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 (Mature Sequence) AACUUGUGAUGAGGUGAGACAG
Sanger 성숙/소수 수납 번호 MIMAT0022360
microRNA 수납 번호 MI0019184
배송 상태 (Shipping) Dry ice
저장 온도 (Storage) −70 °C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design, enabling potent and specific inhibition of target miRNA.

miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection of transduced cells.


주요 특징

  • 강력한 miRNA 억제 효과 제공
  • 렌티바이러스 전달 형식으로 다양한 세포주에 효율적 도입 가능
  • 반복 형질감염 없이 장기적 억제 유지
  • 퓨로마이신 내성 유전자를 통한 세포 선택 용이

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.