Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 Tough Decoy(TuD) 설계를 기반으로 강력한 miRNA 억제를 제공합니다. 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입이 가능하며, 퓨로마이신 저항 유전자를 포함해 안정적 장기 억제를 지원합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-1231-3p
Design Type: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UGCCCUGUCUGUUCUGCCCACAG |
| Sanger 성숙/소수 수납 번호 | MIMAT0022358 |
| microRNA 수납 번호 | MI0019183 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNAs regulate gene expression through various mechanisms, including translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression, and the vector includes a puromycin resistance gene for cell selection.
주요 특징
- 강력하고 지속적인 miRNA 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 도입
- 반복적인 트랜스펙션 없이 장기 억제 효과 유지
- 퓨로마이신 저항성을 통한 안정적 세포 선택 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.