
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 TuD 설계 기반으로 특정 miRNA를 강력히 억제합니다. 렌티바이러스 전달 형식으로 다양한 세포에 효율적으로 도입 가능하며, 장기적인 억제 효과를 제공합니다. −70°C에서 보관하며 드라이아이스로 배송됩니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-5618-5p
Type: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 (Quality Level) | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UACCCUUUACACCGUGUAGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0022363 |
| microRNA 수납 번호 | MI0019186 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNA activity.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
Lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 기능 제공
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입 가능
- 반복적인 트랜스펙션 없이 장기적 억제 효과 유지
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



