CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스용 MISSION Lenti microRNA Inhibitor는 Tough Decoy(TuD) 디자인을 적용한 렌티바이러스 기반 억제제입니다. 효율적인 세포 전달과 장기적인 miRNA 억제가 가능하며, puromycin 선택 마커를 포함합니다. −70°C에서 건빙 상태로 배송됩니다.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0537 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-301b-3p

Type: Tough Decoy (TuD)


제품 정보

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 CAGUGCAAUGGUAUUGUCAAAGC
Sanger 성숙/소수 수납 번호 MIMAT0004186
microRNA 수납 번호 MI0004122
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of specific miRNAs.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) enhances transgene expression in lentiviral systems.
The vector also carries a puromycin resistance gene for selection.


주요 특징

  • 강력한 miRNA 억제 가능
  • 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입
  • 반복적 형질감염 없이 장기적인 억제 유지
  • Puromycin 선택 마커 포함
  • −70°C에서 안정적 보관 및 건빙 상태 배송

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.