Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 Tough Decoy(TuD) 디자인을 적용한 렌티바이러스 기반 억제제입니다. 효율적인 세포 전달과 장기적인 miRNA 억제가 가능하며, puromycin 선택 마커를 포함합니다. −70°C에서 건빙 상태로 배송됩니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-301b-3p
Type: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CAGUGCAAUGGUAUUGUCAAAGC |
| Sanger 성숙/소수 수납 번호 | MIMAT0004186 |
| microRNA 수납 번호 | MI0004122 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of specific miRNAs.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) enhances transgene expression in lentiviral systems.
The vector also carries a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입
- 반복적 형질감염 없이 장기적인 억제 유지
- Puromycin 선택 마커 포함
- −70°C에서 안정적 보관 및 건빙 상태 배송
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.