
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor로 특정 miRNA의 강력한 억제를 제공합니다. Tough Decoy(TuD) 설계를 적용하여 효율적이고 지속적인 억제 효과를 구현합니다. 렌티바이러스 전달 형식으로 다양한 세포에 적용 가능하며, 푸로마이신 저항성 유전자를 포함합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-1247-3p
설계 유형
- Tough Decoy (TuD)
품질 등급
- 200
제품 라인
- MISSION®
물리적 형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- CGGGAACGUCGAGACUGGAGC
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of the desired miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression delivered by lentiviral vectors.
This vector also carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 목표 miRNA 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 적용
- 반복 트랜스펙션 없이 장기 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



