
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-675-5p 억제를 위한 렌티바이러스 기반 microRNA Inhibitor. Tough Decoy(TuD) 디자인으로 강력한 miRNA 억제 가능. 다양한 세포에 효율적 전달 및 장기적 억제 유지. 퓨로마이신 저항성 유전자 포함으로 선택 용이.
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-675-5p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the tough decoy (TuD) design to effectively inhibit target miRNA.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- Potent inhibition of the desired miRNA
- Lentiviral delivery enables efficient transduction into diverse cell types
- Long-term inhibition without repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| Form | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UGGUGCGGAAAGGGCCCACAGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0003725 |
| microRNA 수납 번호 | MI0004123 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
🏷️Merck Sigma 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
716,600원
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|