CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-675-5p 억제를 위한 렌티바이러스 기반 microRNA Inhibitor. Tough Decoy(TuD) 디자인으로 강력한 miRNA 억제 가능. 다양한 세포에 효율적 전달 및 장기적 억제 유지. 퓨로마이신 저항성 유전자 포함으로 선택 용이.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0540 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-675-5p

Tough Decoy (TuD) Design

제품 개요

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the tough decoy (TuD) design to effectively inhibit target miRNA.

miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.

주요 특징

  • Potent inhibition of the desired miRNA
  • Lentiviral delivery enables efficient transduction into diverse cell types
  • Long-term inhibition without repeat transfection

제품 스펙

항목 내용
Quality Level 200
제품 라인 MISSION®
Form Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 UGGUGCGGAAAGGGCCCACAGU
Sanger 성숙/소수 수납 번호 MIMAT0003725
microRNA 수납 번호 MI0004123
배송 상태 Dry ice
저장 온도 −70°C

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.