Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 microRNA 억제용 렌티바이러스 기반 Tough Decoy(TuD) 디자인 적용 효율적이고 지속적인 miRNA 억제 가능 TRC2-pLKO-puro 벡터 기반, 다양한 세포주에 적용 가능 Puromycin 선택 마커 및 WPRE 포함으로 발현 효율 향상 −70°C 보관, 드라이아이스 배송
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-1224-3p
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.
The vector includes Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- Potent inhibition of the desired miRNA
- Efficient delivery into various cell types via lentiviral system
- Enables long-term inhibition without repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| Form | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CCCCACCUCUUCUCUCCUCAG |
| Sanger 성숙/소수 수납 번호 | MIMAT0017231 |
| microRNA 수납 번호 | MI0004118 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.