
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 Tough Decoy(TuD) 설계를 기반으로 한 렌티바이러스 전달 포맷을 사용합니다. 효율적인 세포 내 전달과 장기적 miRNA 억제를 가능하게 하며, 퓨로마이신 선택 마커를 포함합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-468-5p
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA are known to regulate gene expression through:
- Translational repression
- mRNA cleavage
- Deadenylation
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector into an appropriate cell line with compatible packaging plasmids produces viral particles that can transduce mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) is included to enhance transgene expression.
This vector also carries a puromycin resistance gene for cell selection.
주요 특징
- Potent inhibition of the desired miRNA
- Efficient lentiviral delivery into various cell types
- Enables long-term inhibition without repeat transfection
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | GACUGAUGUACUGAUAAGAAACUCAGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0022699 |
| microRNA 수납 번호 | MI0002403 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



