
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 microRNA 억제용 렌티바이러스 기반 TuD 설계 제품. 강력하고 지속적인 miRNA 억제 가능. 다양한 세포주에 효율적으로 전달. puromycin 저항성 유전자로 세포 선별 용이. −70°C에서 보관, 드라이아이스로 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-463-3p
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent and specific miRNA inhibition.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles capable of transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of transduced cells.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 기반 전달로 다양한 세포주에 효율적 적용
- 반복 형질감염 없이 장기 억제 가능
- puromycin 저항성 유전자를 통한 세포 선택 가능
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | UGAUAGACACCAUAUAAGGUAG |
| Sanger 성숙/소수 수납 번호 | MIMAT0004758 |
| microRNA 수납 번호 | MI0002398 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
참고 문헌
Haraguchi, T., et al. (University of Tokyo) — Development of the Tough Decoy (TuD) design for efficient miRNA inhibition.
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



