
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 유래 microRNA 억제용 렌티바이러스 기반 시약으로, Tough Decoy(TuD) 디자인을 적용해 강력한 miRNA 억제 가능. 다양한 세포에 효율적 전달 및 장기적 억제 유지. 퓨로마이신 내성 유전자를 포함하여 선택적 세포 선별 가능.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-465a-5p
- 형태: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | UAUUUAGAAUGGCACUGAUGUGA |
| Sanger 성숙/소수 수납 번호 | MIMAT0002106 |
| microRNA 수납 번호 | MI0002400 |
| 배송 상태 (Shipping Condition) | Dry ice |
| 저장 온도 (Storage Temperature) | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for effective miRNA inhibition.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression, and carries a puromycin resistance gene for selection of transduced cells.
주요 특징
- 목표 miRNA의 강력한 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달
- 반복 형질감염 없이 장기적 억제 유지
- 퓨로마이신 내성 유전자를 통한 세포 선택 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



