
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miR-365-2-5p 억제용 렌티바이러스 기반 microRNA inhibitor. Tough Decoy(TuD) 디자인으로 강력한 억제 효과 제공. 다양한 세포형에 효율적 전달 가능. 장기적 억제 유지 및 퓨로마이신 선택 가능.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-365-2-5p
- 형태: Tough Decoy (TuD)
제품 라인
MISSION®
품질 등급
200
제품 형태 및 농도
| 항목 | 내용 |
|---|---|
| Form | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
서열 정보
| 항목 | 내용 |
|---|---|
| 성숙 서열 | AGGGACUUUCAGGGGCAGCUGUG |
| Sanger 성숙/소수 수납 번호 | MIMAT0017179 |
| microRNA 수납 번호 | MI0001645 |
배송 및 보관
| 항목 | 내용 |
|---|---|
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo). This algorithm utilizes the Tough Decoy (TuD) design.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) enhances transgene expression delivered by lentiviral vectors. The vector also includes a puromycin resistance gene for selection of transduced cells.
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 포맷으로 다양한 세포형에 효율적 전달
- 반복 트랜스펙션 없이 장기적 억제 유지
- 퓨로마이신 선택 마커 포함
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



