Merck MISSION Lenti microRNA Inhibitor, Mouse
강력한 miRNA 억제 기능 제공. 렌티바이러스 전달로 다양한 세포 유형에 효율적 적용. 반복 형질감염 없이 장기 억제 가능. Tough Decoy(TuD) 설계 기반으로 높은 특이성과 안정성 확보.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 miRNA
mmu-miR-450a-1-3p
설계 방식
Tough Decoy (TuD) 디자인 기반
품질 등급
200 (M-Clarity Program)
제품 라인
MISSION®
제품 형태 및 특성
| 항목 | 내용 |
|---|---|
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AUUGGGAACAUUUUGCAUAAAU |
| Sanger 성숙/소수 수납 번호 | MIMAT0017182 |
| microRNA 수납 번호 | MI0001653 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi, T. et al. This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of target miRNA.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 전달로 다양한 세포 유형에 효율적 적용
- 반복 형질감염 없이 장기 억제 가능
제품 이미지
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.