
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-452-3p를 표적하는 Tough Decoy 기반 렌티바이러스형 microRNA 억제제. 효율적인 세포 전달 및 장기적 억제 가능. TRC2-pLKO-puro 벡터 사용, 퓨로마이신 선택 가능. −70°C에서 건빙 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 miRNA
- mmu-miR-452-3p
디자인
- Tough Decoy (TuD) 기반 설계
품질 등급
- 200 (M-Clarity Program)
제품 라인
- MISSION®
물리적 형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- UCAGUCUCAUCUGCAAAGAGGU
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNA activity.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 강력한 표적 miRNA 억제 가능
- 다양한 세포 유형에 효율적 전달
- 반복 트랜스펙션 없이 장기적 억제 유지
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



