
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miRNA 억제를 위한 렌티바이러스 기반 Tough Decoy 디자인 적용. 효율적이고 지속적인 miRNA 억제 가능. 다양한 세포 유형에 안정적으로 전달. −70°C에서 건빙 상태로 배송.
- 카탈로그번호
- MLTUD1138
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-3104-5p
디자인
- Tough Decoy (TuD) 방식 적용
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design. miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles that can transduce mammalian cells.
The Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) is included for enhanced transgene expression.
This vector also carries a puromycin resistance gene for selection of transduced cells.
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 전달 포맷으로 다양한 세포 유형에 적용 가능
- 반복적인 트랜스펙션 없이 장기 억제 가능
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UAGGGGGCAGGAGCCGGAGCCCUCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0014939 |
| microRNA 수납 번호 | MI0014101 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



