Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-3102-5p

디자인

• Tough Decoy (TuD)

품질 등급

• 200 (M-Clarity Program)

제품 라인

• MISSION®

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• GUGAGUGGCCAGGGUGGGGCUG

Sanger 성숙/소수 수납 번호

• MIMAT0014933

microRNA 수납 번호

• MI0014099

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for effective inhibition of target miRNA.

miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.

The vector includes:

• Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression
• Puromycin resistance gene for selection of transduced cells

주요 특징

• 강력한 miRNA 억제 가능
• 다양한 세포에 효율적인 렌티바이러스 전달
• 반복적인 트랜스펙션 없이 장기적 억제 유지
• 퓨로마이신 저항성 유전자를 통한 선택 가능