
Merck MISSION Lenti microRNA Inhibitor, Mouse
포유류 세포에서 miRNA 기능 억제를 위한 렌티바이러스 기반 억제제. Tough Decoy(TuD) 디자인을 적용하여 강력하고 지속적인 miRNA 억제 가능. TRC2-pLKO-puro 벡터와 puromycin 선택 마커 포함. −70°C에서 건빙 상태로 배송.
- 카탈로그번호
- MLTUD1135
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-3103-5p
디자인
- Tough Decoy (TuD)
품질 등급
- 200
제품 라인
- MISSION®
제형
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- GGAGGGAGGAUCUGCUGUUAG
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 포맷으로 다양한 세포에 효율적 전달
- 반복적인 트랜스펙션 없이 장기 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



