
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-335-3p 억제를 위한 렌티바이러스 기반 microRNA inhibitor TuD(Tough Decoy) 디자인으로 강력한 miRNA 억제 가능 TRC2-pLKO-puro 벡터 기반으로 다양한 세포주에 효율적 전달 Puromycin 저항성 유전자를 포함하여 안정적인 세포 선택 가능 −70°C에서 보관, 드라이아이스 배송
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-335-3p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which allows co-transfection with compatible packaging plasmids to produce viral particles for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.
주요 특징
- Potent inhibition of the desired miRNA
- Lentiviral delivery enables efficient transduction across various cell types
- Long-term inhibition without repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UUUUUCAUUAUUGCUCCUGACC |
| Sanger 성숙/소수 수납 번호 | MIMAT0004704 |
| microRNA 수납 번호 | MI0000817 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
🏷️Merck Sigma 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|