
Merck MISSION Lenti microRNA Inhibitor, Mouse
강력한 miRNA 억제 효과 제공. Lentiviral 전달로 다양한 세포에 효율적 적용 가능. 반복 형질감염 없이 장기적 억제 유지. Tough Decoy(TuD) 설계 기반으로 높은 특이성과 안정성 확보.
- 카탈로그번호
- MLTUD0424
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
제품 정보
- Target miRNA: mmu-miR-335-5p
- Design Type: Tough Decoy (TuD)
품질 등급
200 (M-Clarity Program)
제품 라인
MISSION®
물리적 형태
liquid
농도
≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
UCAAGAGCAAUAACGAAAAAUGU
상거(Sanger) 성숙/소수 수납 번호
microRNA 수납 번호
MI0000817
배송 상태
dry ice
저장 온도
−70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba, University of Tokyo, and based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design for effective inhibition of target miRNA.
MicroRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, when co-transfected with compatible packaging plasmids, produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection.
주요 특징
- Potent inhibition of target miRNA
- Efficient delivery to a wide variety of cell types via lentiviral system
- Long-term inhibition without repeat transfection
- Includes WPRE for enhanced expression
- Contains puromycin resistance marker for selection
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



