CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

강력한 miRNA 억제 효과 제공. Lentiviral 전달로 다양한 세포에 효율적 적용 가능. 반복 형질감염 없이 장기적 억제 유지. Tough Decoy(TuD) 설계 기반으로 높은 특이성과 안정성 확보.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0424 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

제품 정보

  • Target miRNA: mmu-miR-335-5p
  • Design Type: Tough Decoy (TuD)

품질 등급

200 (M-Clarity Program)

제품 라인

MISSION®

물리적 형태

liquid

농도

≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

UCAAGAGCAAUAACGAAAAAUGU

상거(Sanger) 성숙/소수 수납 번호

MIMAT0000766

microRNA 수납 번호

MI0000817

배송 상태

dry ice

저장 온도

−70°C


제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba, University of Tokyo, and based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design for effective inhibition of target miRNA.

MicroRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, when co-transfected with compatible packaging plasmids, produces viral particles suitable for mammalian cell transduction.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection.

주요 특징

  • Potent inhibition of target miRNA
  • Efficient delivery to a wide variety of cell types via lentiviral system
  • Long-term inhibition without repeat transfection
  • Includes WPRE for enhanced expression
  • Contains puromycin resistance marker for selection

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.