Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

제품 정보

• Target miRNA: mmu-miR-335-5p
• Design Type: Tough Decoy (TuD)

품질 등급

200 (M-Clarity Program)

제품 라인

MISSION®

물리적 형태

liquid

농도

≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

UCAAGAGCAAUAACGAAAAAUGU

상거(Sanger) 성숙/소수 수납 번호

MIMAT0000766

microRNA 수납 번호

MI0000817

배송 상태

dry ice

저장 온도

−70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba, University of Tokyo, and based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design for effective inhibition of target miRNA.

MicroRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, when co-transfected with compatible packaging plasmids, produces viral particles suitable for mammalian cell transduction.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection.

주요 특징

• Potent inhibition of target miRNA
• Efficient delivery to a wide variety of cell types via lentiviral system
• Long-term inhibition without repeat transfection
• Includes WPRE for enhanced expression
• Contains puromycin resistance marker for selection