
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 microRNA 억제용 렌티바이러스 기반 Tough Decoy(TuD) 벡터 제품. 효율적 유전자 발현 조절 연구에 적합. 다양한 세포주에 안정적 전달 가능. 장기적 miRNA 억제 효과 제공. 퓨로마이신 내성 유전자를 포함하여 세포 선택 용이.
- 카탈로그번호
- MLTUD0414
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-379-3p
형태: Tough Decoy (TuD)
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UAUGUAACAUGGUCCACUAACU |
| Sanger 성숙/소수 수납 번호 | MIMAT0017080 |
| microRNA 수납 번호 | MI0000796 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for effective inhibition of target miRNA.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) enhances transgene expression, and the vector includes a puromycin resistance gene for cell selection.
주요 특징
- 원하는 miRNA의 강력한 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포주에 효율적 적용
- 반복적인 트랜스펙션 없이 장기적인 miRNA 억제 가능
- 퓨로마이신 내성 유전자를 통한 안정적 세포 선택
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



