Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miR-377-3p 억제용 렌티바이러스 기반 microRNA Inhibitor로, Tough Decoy(TuD) 설계를 적용한 고효율 miRNA 억제제입니다. 다양한 세포 유형에 안정적으로 전달되며, 장기적인 miRNA 억제 효과를 제공합니다.
- 카탈로그번호
- MLTUD0411
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-377-3p
Tough Decoy (TuD) Design
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AUCACACAAAGGCAACUUUUGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000741 |
| microRNA 수납 번호 | MI0000794 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70 °C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 강력한 miRNA 억제 효과
- 다양한 세포 유형에 효율적인 렌티바이러스 전달
- 반복적인 트랜스펙션 없이 장기적 억제 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.