
Merck MISSION Lenti microRNA Inhibitor, Mouse
miRNA 발현 억제를 위한 렌티바이러스 기반 마우스 microRNA 억제제. Tough Decoy(TuD) 설계로 강력한 억제 효과 제공. 다양한 세포 유형에 효율적으로 전달 가능. 장기적 억제 효과 유지. −70°C에서 보관, 드라이아이스 배송.
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-135b-3p
Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 (Quality Level) | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | AUGUAGGGCUAAAAGCCAUGGG |
| Sanger 성숙/소수 수납 번호 | MIMAT0017044 |
| microRNA 수납 번호 | MI0000646 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo). This algorithm utilizes the Tough Decoy (TuD) design.
microRNA (miRNA) are known to regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into suitable cell lines with compatible packaging plasmids produces viral particles capable of transducing mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) is included to enhance expression of transgenes delivered by lentiviral vectors. The vector also carries a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 특정 miRNA의 강력한 억제 가능
- 렌티바이러스 전달 방식으로 다양한 세포에 효율적 전달
- 반복 형질감염 없이 장기적 억제 효과 유지
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



