
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 Tough Decoy(TuD) 디자인을 적용한 렌티바이러스 기반 miRNA 억제제입니다. 다양한 세포에 효율적으로 전달되며, 장기적인 miRNA 억제 효과를 제공합니다. puromycin 선택 마커와 WPRE 요소를 포함하여 안정적인 발현을 지원합니다.
- 카탈로그번호
- MLTUD0306
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-10a-3p
Tough Decoy (TuD) Design
품질 등급
200
제품 라인
MISSION®
형태
Liquid
농도
≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
CAAAUUCGUAUCUAGGGGAAUA
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
MI0000685
배송 상태
Dry ice
저장 온도
−70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of target miRNAs.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 강력한 miRNA 억제 효과 제공
- 다양한 세포 유형에 효율적으로 전달 가능한 렌티바이러스 포맷
- 반복적인 트랜스펙션 없이 장기적인 억제 가능
제품 사양 요약
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (p24 assay) |
| 성숙 서열 | CAAAUUCGUAUCUAGGGGAAUA |
| Sanger 성숙 번호 | MIMAT0004659 |
| microRNA 수납 번호 | MI0000685 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



