
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 microRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 디자인의 억제제. 다양한 세포 유형에 효율적으로 전달 가능하며, 장기적 miRNA 억제 유지. 품질 등급 200, 액상 형태, −70°C 보관.
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-135b-5p
- 형태: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| Product Line | MISSION® |
| Form | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | UAUGGCUUUUCAUUCCUAUGUGA |
| Sanger 성숙/소수 수납 번호 | MIMAT0000612 |
| microRNA 수납 번호 | MI0000646 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 원하는 miRNA의 강력한 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 전달
- 반복 형질감염 없이 장기적 억제 유지
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



