CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 miR-324-5p 억제를 위한 Tough Decoy 기반 렌티바이러스형 microRNA 억제제. 효율적이고 지속적인 miRNA 억제 가능. TRC2-pLKO-puro 벡터 및 WPRE 포함으로 발현 강화. 푸로마이신 저항성 유전자 포함, 다양한 세포주에 적용 가능.

카탈로그번호
MLTUD0261
브랜드
Merck Sigma
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0261 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
848,400원VAT 포함 933,240원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

  • mmu-miR-324-5p

Design Type

  • Tough Decoy (TuD)

제품 라인

  • MISSION®

품질 등급

  • 200

형태

  • Liquid

농도

  • ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

  • CGCAUCCCCUAGGGCAUUGGUGU

Sanger 성숙/소수 수납 번호

microRNA 수납 번호

  • MI0000595

배송 상태

  • Dry ice

저장 온도

  • −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of specific miRNA targets.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which co-transfected with compatible packaging plasmids produces viral particles for transduction into mammalian cells.

The vector includes:

  • Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
  • Puromycin resistance gene for selection of successfully transduced cells

주요 특징

  • 강력하고 선택적인 miRNA 억제 가능
  • 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 적용
  • 반복적인 트랜스펙션 없이 장기 억제 가능
  • 안정적인 발현 및 선택적 세포 생존 보장

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.