Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

• mmu-miR-324-5p

Design Type

• Tough Decoy (TuD)

제품 라인

• MISSION®

품질 등급

• 200

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• CGCAUCCCCUAGGGCAUUGGUGU

Sanger 성숙/소수 수납 번호

• MIMAT0000555

microRNA 수납 번호

• MI0000595

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of specific miRNA targets.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which co-transfected with compatible packaging plasmids produces viral particles for transduction into mammalian cells.

The vector includes:

• Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
• Puromycin resistance gene for selection of successfully transduced cells

주요 특징

• 강력하고 선택적인 miRNA 억제 가능
• 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 적용
• 반복적인 트랜스펙션 없이 장기 억제 가능
• 안정적인 발현 및 선택적 세포 생존 보장