
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 Tough Decoy(TuD) 디자인 기반으로 특정 miRNA를 강력하게 억제합니다. 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입이 가능하며, 반복적인 트랜스펙션 없이 장기 억제가 가능합니다. −70°C에서 보관하며 드라이아이스로 배송됩니다.
- 카탈로그번호
- MLTUD0255
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-103-2-5p
디자인
- Tough Decoy (TuD)
품질 등급
- 200
제품 라인
- MISSION®
형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- AGCUUCUUUACAGUGCUGCCUUG
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
- MI0000588
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for efficient miRNA inhibition.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which upon co-transfection with compatible packaging plasmids, produces viral particles suitable for mammalian cell transduction.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 전달로 다양한 세포 유형에 효율적 도입
- 반복 트랜스펙션 없이 장기적 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



