
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 디자인 적용. 다양한 세포 유형에 효율적으로 전달 가능. 장기적인 miRNA 억제 효과 제공. 퓨로마이신 저항성 유전자 포함으로 선택적 세포 배양 가능.
- 카탈로그번호
- MLTUD0273
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
- mmu-miR-331-3p
Design Type
- Tough Decoy (TuD)
제품 특징
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi, T. et al. This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of specific miRNAs.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 장점
- Potent inhibition of target miRNA
- Efficient delivery via lentiviral system
- Long-term inhibition without repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | GCCCCUGGGCCUAUCCUAGAA |
| Sanger 성숙/소수 수납 번호 | MIMAT0000571 |
| microRNA 수납 번호 | MI0000609 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



