CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 miRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 디자인 적용. 다양한 세포 유형에 효율적으로 전달 가능. 장기적인 miRNA 억제 효과 제공. 퓨로마이신 저항성 유전자 포함으로 선택적 세포 배양 가능.

카탈로그번호
MLTUD0273
브랜드
Merck Sigma
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0273 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

  • mmu-miR-331-3p

Design Type

  • Tough Decoy (TuD)

제품 특징

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi, T. et al. This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of specific miRNAs.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

The vector includes:

  • WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
  • Puromycin resistance gene for selection of transduced cells

주요 장점

  • Potent inhibition of target miRNA
  • Efficient delivery via lentiviral system
  • Long-term inhibition without repeat transfection

제품 스펙

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 GCCCCUGGGCCUAUCCUAGAA
Sanger 성숙/소수 수납 번호 MIMAT0000571
microRNA 수납 번호 MI0000609
배송 상태 Dry ice
저장 온도 −70°C

제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.