Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

• mmu-miR-144-3p

디자인

• Tough Decoy (TuD) 방식 적용

품질 등급

• 200

제품 라인

• MISSION®

물리적 형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UACAGUAUAGAUGAUGUACU

Sanger 성숙/소수 수납 번호

• MIMAT0000156

microRNA 수납 번호

• MI0000168

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. and developed in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design for potent and specific inhibition of target miRNA.

MicroRNAs regulate gene expression via translational repression, mRNA cleavage, and deadenylation.
These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.

The vector includes:

• WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element) for enhanced transgene expression
• Puromycin resistance gene for selection of successfully transduced cells

주요 특징

• 강력한 목표 miRNA 억제 가능
• 렌티바이러스 전달 포맷으로 다양한 세포형에 효율적 전달
• 반복 트랜스펙션 없이 장기적 억제 유지