
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-144-3p 억제를 위한 렌티바이러스 기반 microRNA inhibitor. Tough Decoy(TuD) 디자인으로 강력하고 지속적인 억제 가능. 다양한 세포형에 효율적으로 전달되며, 퓨로마이신 저항성 유전자를 포함.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 miRNA
- mmu-miR-144-3p
디자인
- Tough Decoy (TuD) 방식 적용
품질 등급
- 200
제품 라인
- MISSION®
물리적 형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- UACAGUAUAGAUGAUGUACU
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
- MI0000168
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. and developed in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design for potent and specific inhibition of target miRNA.
MicroRNAs regulate gene expression via translational repression, mRNA cleavage, and deadenylation.
These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element) for enhanced transgene expression
- Puromycin resistance gene for selection of successfully transduced cells
주요 특징
- 강력한 목표 miRNA 억제 가능
- 렌티바이러스 전달 포맷으로 다양한 세포형에 효율적 전달
- 반복 트랜스펙션 없이 장기적 억제 유지
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



