CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-141-3p를 표적으로 하는 렌티바이러스 기반 microRNA 억제제입니다. Tough Decoy(TuD) 디자인을 적용하여 강력한 miRNA 억제 효과를 제공합니다. 다양한 세포 유형에 효율적으로 전달 가능하며, 장기적인 억제 효과를 유지합니다. −70°C에서 보관하며 드라이아이스로 배송됩니다.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0058 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

  • mmu-miR-141-3p

디자인

  • Tough Decoy (TuD) 기반 설계

품질 등급

  • 200

제품 라인

  • MISSION®

형태

  • Liquid

농도

  • ≥ 1×10⁶ VP/ml (via p24 assay)

성숙 서열

  • UAACACUGUCUGGUAAAGAUGG

Sanger 성숙/소수 수납 번호

microRNA 수납 번호

  • MI0000166

배송 상태

  • Dry ice

저장 온도

  • −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of the desired miRNA.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

The vector includes:

  • Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression
  • Puromycin resistance gene for selection of transduced cells

주요 특징

  • 강력한 miRNA 억제 효과 제공
  • 렌티바이러스 전달 포맷으로 다양한 세포 유형에 효율적 전달
  • 반복적인 트랜스펙션 없이 장기적 억제 가능

Merck Sigma 상품 둘러보기

전체보기

문의

0개

아직 등록된 문의가 없어요.