Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miR-128-3p 억제를 위한 렌티바이러스 기반 microRNA inhibitor. Tough Decoy(TuD) 설계로 강력하고 지속적인 억제 가능. 다양한 세포에 효율적 전달 및 푸로마이신 선택마커 포함. −70°C에서 건빙 배송.
- 카탈로그번호
- MLTUD0036
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-128-3p
설계 방식
- Tough Decoy (TuD) 기반 설계
- Haraguchi, T. 및 Dr. Hideo Iba(도쿄대) 연구에 기반한 독자 알고리즘 사용
품질 등급
- 200 (M-Clarity Program)
제품 라인
- MISSION®
제품 형태 및 사양
| 항목 | 내용 |
|---|---|
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UCACAGUGAACCGGUCUCUUU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000140 |
| microRNA 수납 번호 | MI0000726 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi et al. and in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design. miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles for transduction into mammalian cells.
The construct includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 원하는 miRNA에 대한 강력한 억제 효과
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입 가능
- 반복 트랜스펙션 없이 장기 억제 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.