
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-99a-5p를 표적하는 렌티바이러스 기반 microRNA 억제제. Tough Decoy(TuD) 설계를 적용해 강력하고 지속적인 miRNA 억제 가능. 다양한 세포에 효율적 전달 및 퓨로마이신 선택 마커 포함. −70°C에서 건빙 상태로 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-99a-5p
- 형태: Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNAs regulate gene expression via translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력하고 지속적인 miRNA 억제 효과
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 도입 가능
- 반복적인 트랜스펙션 없이 장기 억제 가능
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AACCCGUAGAUCCGAUCUUGUG |
| Sanger 성숙/소수 수납 번호 | MIMAT0000131 |
| microRNA 수납 번호 | MI0000146 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



