Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-30b-5p

디자인

• Tough Decoy (TuD) 기반

제품 라인

• MISSION®

품질 등급

• 200 (M-Clarity Program)

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UGUAAACAUCCUACACUCAGCU

Sanger 성숙/수납 번호

• MIMAT0000130

microRNA 수납 번호

• MI0000145

배송 상태

• Dry Ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNAs.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which can be co-transfected with packaging plasmids to produce viral particles for mammalian cell transduction.

The vector includes:

• WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
• Puromycin resistance gene for cell selection

주요 특징

• 강력한 miRNA 억제 효과 제공
• 렌티바이러스 전달 포맷으로 다양한 세포 유형에 효율적 전달
• 반복적인 트랜스펙션 없이 장기적 억제 가능