
Merck MISSION Lenti microRNA Inhibitor, Mouse
개별 렌티바이러스 기반 microRNA 억제제로, TuD 디자인을 적용하여 특정 miRNA의 강력한 억제를 제공합니다. 다양한 세포 유형에 효율적으로 전달되며, 재형질감염 없이 장기적인 억제 효과를 유지합니다. 퓨로마이신 내성 유전자를 포함합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-5124a
Tough Decoy (TuD) Design
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | GGUCCAGUGACUAAGAGCAU |
| Sanger 성숙/소수 수납 번호 | MIMAT0020634 |
| 저장 온도 (Storage Temp.) | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design, known for effective inhibition of target miRNAs.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) to enhance transgene expression and carries a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 형식을 통한 다양한 세포 유형에서의 효율적 전달
- 재형질감염 없이 장기적 억제 가능
- 퓨로마이신 내성 유전자 포함으로 선택 용이
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



