CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

개별 렌티바이러스 기반 microRNA 억제제로, TuD 디자인을 적용하여 특정 miRNA의 강력한 억제를 제공합니다. 다양한 세포 유형에 효율적으로 전달되며, 재형질감염 없이 장기적인 억제 효과를 유지합니다. 퓨로마이신 내성 유전자를 포함합니다.

카탈로그번호
MLTUD0366
브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0366 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-5124a

Tough Decoy (TuD) Design


제품 스펙

항목 내용
Quality Level 200
제품 라인 MISSION®
형태 (Form) Liquid
농도 (Concentration) ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 (Mature Sequence) GGUCCAGUGACUAAGAGCAU
Sanger 성숙/소수 수납 번호 MIMAT0020634
저장 온도 (Storage Temp.) −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design, known for effective inhibition of target miRNAs.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) to enhance transgene expression and carries a puromycin resistance gene for selection.


주요 특징

  • 강력한 miRNA 억제 효과 제공
  • 렌티바이러스 전달 형식을 통한 다양한 세포 유형에서의 효율적 전달
  • 재형질감염 없이 장기적 억제 가능
  • 퓨로마이신 내성 유전자 포함으로 선택 용이

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.