
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-5134-5p 억제용 렌티바이러스 기반 microRNA 억제제. Tough Decoy(TuD) 디자인 적용으로 강력한 miRNA 억제 효과 제공. 다양한 세포에 효율적 전달 및 장기적 억제 가능. Puromycin 선택 마커 포함.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 miRNA
- mmu-miR-5134-5p
디자인
- Tough Decoy (TuD) 구조 적용
제품 라인
- MISSION®
품질 등급
- 200 (M-Clarity Program)
형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- UUGGCAGAAAGGGCAGCUGUG
Sanger 성숙/소수 수납 번호
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of the target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which allows efficient production of viral particles via co-transfection with compatible packaging plasmids. These particles can be used to transduce mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression.
The vector also includes a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 다양한 세포 유형에 효율적 렌티바이러스 전달 가능
- 반복적인 트랜스펙션 없이 장기적 억제 유지
- Puromycin 선택 마커 포함
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



