Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

• mmu-miR-5134-5p

디자인

• Tough Decoy (TuD) 구조 적용

제품 라인

• MISSION®

품질 등급

• 200 (M-Clarity Program)

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UUGGCAGAAAGGGCAGCUGUG

Sanger 성숙/소수 수납 번호

• MIMAT0020645

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of the target miRNA.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which allows efficient production of viral particles via co-transfection with compatible packaging plasmids. These particles can be used to transduce mammalian cells.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression.
The vector also includes a puromycin resistance gene for selection of successfully transduced cells.

주요 특징

• 강력한 miRNA 억제 효과 제공
• 다양한 세포 유형에 효율적 렌티바이러스 전달 가능
• 반복적인 트랜스펙션 없이 장기적 억제 유지
• Puromycin 선택 마커 포함