
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-5107-3p를 표적하는 Lentiviral microRNA 억제제입니다. Tough Decoy(TuD) 설계를 적용해 강력한 억제 효과를 제공합니다. 다양한 세포 유형에 효율적으로 전달되며, 장기적인 억제 효과를 유지합니다. Puromycin 선택 마커 및 WPRE 포함으로 발현 효율 향상.
- 카탈로그번호
- MLTUD0364
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-5107-3p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi, T. et al.
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression.
This vector also carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 (TuD 구조 적용)
- Lentiviral 전달 방식으로 다양한 세포 유형에 효율적 적용
- 반복적인 형질감염 없이 장기적 억제 가능
- Puromycin 저항성 유전자 및 WPRE 포함으로 발현 효율 향상
제품 스펙
| 항목 | 내용 |
|---|---|
| 제품 라인 | MISSION® |
| 품질 등급 | 200 |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CAACCUGUGCUUCUCUUCCCAG |
| Sanger 성숙/소수 수납 번호 | MIMAT0022985 |
| 저장 온도 | −70°C |
참고 정보
Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types.
Enables long-term inhibition without repeat transfection.
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



