CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-5107-3p를 표적하는 Lentiviral microRNA 억제제입니다. Tough Decoy(TuD) 설계를 적용해 강력한 억제 효과를 제공합니다. 다양한 세포 유형에 효율적으로 전달되며, 장기적인 억제 효과를 유지합니다. Puromycin 선택 마커 및 WPRE 포함으로 발현 효율 향상.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0364 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-5107-3p

Tough Decoy (TuD) Design


제품 개요

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi, T. et al.
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.

miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression.
This vector also carries a puromycin resistance gene for cell selection.


주요 특징

  • 강력한 miRNA 억제 효과 (TuD 구조 적용)
  • Lentiviral 전달 방식으로 다양한 세포 유형에 효율적 적용
  • 반복적인 형질감염 없이 장기적 억제 가능
  • Puromycin 저항성 유전자 및 WPRE 포함으로 발현 효율 향상

제품 스펙

항목 내용
제품 라인 MISSION®
품질 등급 200
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 CAACCUGUGCUUCUCUUCCCAG
Sanger 성숙/소수 수납 번호 MIMAT0022985
저장 온도 −70°C

참고 정보

Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types.
Enables long-term inhibition without repeat transfection.


제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0개

아직 등록된 문의가 없어요.