
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-5107-5p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제. 다양한 세포에 효율적 전달 및 장기 억제 가능. TRC2-pLKO-puro 벡터 사용, puromycin 내성 및 WPRE 포함. −70°C에서 보관.
- 카탈로그번호
- MLTUD0365
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-5107-5p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to effectively inhibit target miRNA activity.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which upon co-transfection with compatible packaging plasmids produces viral particles for transduction into mammalian cells.
This vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달
- 반복적인 트랜스펙션 없이 장기 억제 가능
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UGGGCAGAGGAGGCAGGGACA |
| Sanger 성숙/소수 수납 번호 | MIMAT0020615 |
| 저장 온도 | −70°C |
참고 문헌
Haraguchi, T. et al., and Dr. Hideo Iba, University of Tokyo — Tough Decoy (TuD) design reference.
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



