
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-291a-5p 억제를 위한 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제입니다. TRC2-pLKO-puro 벡터를 사용하며, puromycin 선택 마커와 WPRE 요소를 포함합니다. 효율적 전달 및 장기 억제 가능.
- 카탈로그번호
- MLTUD0139
- 브랜드
- Merck Sigma
- 카테고리
- Other Organics
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-291a-5p
디자인
- Tough Decoy (TuD) 기반 설계
품질 등급
- 200 (Merck M-Clarity Program)
제품 라인
- MISSION®
물리적 형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- CAUCAAAGUGGAGGCCCUCUCU
등록 정보
| 항목 | 내용 |
|---|---|
| Sanger 성숙/소수 수납 번호 | MIMAT0000367 |
| microRNA 수납 번호 | MI0000389 |
배송 및 보관
| 항목 | 내용 |
|---|---|
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm utilizes the Tough Decoy (TuD) design for effective microRNA inhibition.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
The lentiviral delivery format enables efficient transduction into diverse mammalian cell types and supports long-term inhibition without the need for repeated transfection.
주요 특징
- 강력한 목표 miRNA 억제 가능
- 렌티바이러스 기반 전달로 다양한 세포형에 효율적 적용
- 반복적인 트랜스펙션 없이 장기 억제 유지
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



