Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-291a-5p

디자인

• Tough Decoy (TuD) 기반 설계

품질 등급

• 200 (Merck M-Clarity Program)

제품 라인

• MISSION®

물리적 형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• CAUCAAAGUGGAGGCCCUCUCU

등록 정보

배송 및 보관

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm utilizes the Tough Decoy (TuD) design for effective microRNA inhibition.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which includes:

• WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element) for enhanced transgene expression
• Puromycin resistance gene for selection of transduced cells

The lentiviral delivery format enables efficient transduction into diverse mammalian cell types and supports long-term inhibition without the need for repeated transfection.

주요 특징

• 강력한 목표 miRNA 억제 가능
• 렌티바이러스 기반 전달로 다양한 세포형에 효율적 적용
• 반복적인 트랜스펙션 없이 장기 억제 유지