Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-290-5p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제. 효율적이고 지속적인 miRNA 억제를 제공하며, 다양한 세포에 안정적으로 전달 가능. puromycin 저항성 유전자 포함으로 선택 배양 용이.
- 카탈로그번호
- MLTUD0137
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
- mmu-miR-290-5p
Design Type
- Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | ACUCAAACUAUGGGGGCACUUU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000366 |
| microRNA 수납 번호 | MI0000388 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of the target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids generates viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달
- 반복적인 트랜스펙션 없이 장기적인 억제 가능
- puromycin 선택 마커 포함
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.