CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

Tough Decoy(TuD) 설계를 기반으로 한 렌티바이러스 형식의 microRNA 억제제. 다양한 세포 유형에 효율적으로 전달 가능하며, 장기적인 miRNA 억제 효과 제공. 퓨로마이신 내성 유전자를 포함하여 안정적인 세포 선택 가능.

카탈로그번호
MLTUD1064
브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD1064 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

제품 개요

  • 타깃 miRNA: mmu-miR-669p-3p
  • 디자인: Tough Decoy (TuD) 기반
  • 제품 라인: MISSION®
  • 형태: Liquid
  • 농도: ≥1×10⁶ VP/ml (via p24 assay)
  • 배송 상태: Dry ice
  • 저장 온도: −70°C

서열 정보

구분 내용
성숙 서열 CAUAACAUACACACACACACGUAU
Sanger 성숙/소수 수납 번호 MIMAT0014890
microRNA 수납 번호 MI0014064, MI0014071

품질 등급

항목 등급
Quality Level 200

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo). This algorithm employs the Tough Decoy (TuD) design to achieve robust inhibition of target miRNA.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles capable of transducing mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for stable cell selection.

주요 특징

  • 강력한 miRNA 억제 효과 제공
  • 다양한 세포 유형에 효율적인 렌티바이러스 전달 가능
  • 반복 형질감염 없이 장기적인 억제 유지
  • 퓨로마이신 내성 유전자를 통한 안정적 세포 선택 가능

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.