Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miRNA 억제용 렌티바이러스 기반 시약으로, 강력하고 지속적인 miRNA 억제 가능. Tough Decoy(TuD) 설계를 적용하여 효율적 억제 제공. 다양한 세포 유형에 렌티바이러스 전달 가능. 퓨로마이신 내성 유전자를 포함해 선택적 세포 선별 가능.
- 카탈로그번호
- MLTUD1034
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-3086-5p
Tough Decoy (TuD) Design
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UAGAUUGUAGGCCCAUUGGA |
| Sanger 성숙/소수 수납 번호 | MIMAT0014880 |
| microRNA 수납 번호 | MI0014049 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) is included to enhance expression of transgenes delivered by lentiviral vectors.
This lentiviral vector also carries a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 포맷으로 다양한 세포 유형에 효율적 전달 가능
- 반복적인 트랜스펙션 없이 장기적인 억제 가능
- 퓨로마이신 내성 유전자 포함으로 선택적 세포 선별 용이
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.