Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 microRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 인히비터. 효율적인 전달과 장기적인 억제 가능. TRC2-pLKO-puro 벡터 사용 및 퓨로마이신 내성 유전자 포함. −70°C에서 건빙 상태로 배송.
- 카탈로그번호
- MLTUD1020
- 브랜드
- Merck Sigma
- 카테고리
- Other Organics
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-3079-5p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design to efficiently inhibit target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, co-transfected with compatible packaging plasmids to produce viral particles for mammalian cell transduction.
Contains WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- Potent inhibition of the desired miRNA
- Lentiviral format ensures efficient delivery to diverse cell types
- Enables long-term inhibition without repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UUUGAUCUGAUGAGCUAAGCUGG |
| Sanger 성숙/소수 수납 번호 | MIMAT0014866 |
| microRNA 수납 번호 | MI0014042 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음 또는 별도 제공 시 하단에 배치)
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.