
Merck MISSION Lenti microRNA Inhibitor, Mouse
Tough Decoy(TuD) 설계 기반의 마우스용 렌티바이러스 microRNA 억제제. miRNA의 발현 억제에 효과적이며 다양한 세포에 안정적 전달 가능. 퓨로마이신 내성 유전자를 포함하여 선택적 세포 선별 가능. −70°C에서 보관.
- 카탈로그번호
- MLTUD0057
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-141-5p
Tough Decoy (TuD) 설계 기반 microRNA 억제제
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent and specific inhibition of target miRNA.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, when co-transfected with compatible packaging plasmids, produces viral particles suitable for mammalian cell transduction.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
- Puromycin resistance gene for selection of successfully transduced cells
주요 특징
- 목표 miRNA의 강력한 억제 가능
- 렌티바이러스 전달 포맷으로 다양한 세포에 효율적 전달
- 반복 형질감염 없이 장기 억제 가능
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | CAUCUUCCAGUGCAGUGUUGGA |
| Sanger 성숙/소수 수납 번호 | MIMAT0004533 |
| microRNA 수납 번호 | MI0000166 |
| 배송 상태 (Shipping Condition) | Dry ice |
| 저장 온도 (Storage Temperature) | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



