Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 Tough Decoy(TuD) 설계를 적용해 특정 miRNA를 강력히 억제합니다. 렌티바이러스 전달 형식으로 다양한 세포에 효율적으로 도입 가능하며, 퓨로마이신 내성 유전자를 포함해 장기적인 억제 효과를 제공합니다.
- 카탈로그번호
- MLTUD0978
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-1251-3p
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm utilizes the Tough Decoy (TuD) design.
miRNA are known to regulate gene expression in various ways, including translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into suitable cell lines with compatible packaging plasmids produces viral particles that can transduce mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included to enhance transgene expression.
This vector also carries a puromycin resistance gene for selection of transduced cells.
주요 특징
- 강력한 miRNA 억제 효과
- 다양한 세포 유형에 효율적으로 전달 가능
- 반복적인 트랜스펙션 없이 장기적인 억제 유지
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CGCUUUGCUCAGCCAGUGUAG |
| Sanger 성숙/소수 수납 번호 | MIMAT0014825 |
| microRNA 수납 번호 | MI0014021 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.