
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miRNA 억제용 렌티바이러스 기반 Tough Decoy(TuD) 디자인 제품 효율적인 세포 내 전달 및 장기적 miRNA 억제 가능 TRC2-pLKO-puro 벡터 기반, 퓨로마이신 내성 유전자 포함 −70°C에서 보관, 드라이아이스 배송
- 카탈로그번호
- MLTUD0980
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 miRNA
- mmu-miR-3060-5p
디자인
- Tough Decoy (TuD) 기반
제품 라인
- MISSION®
품질 등급
- 200 (M-Clarity Program)
제품 형태 및 사양
| 항목 | 내용 |
|---|---|
| 형태(Form) | Liquid |
| 농도(Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열(Mature Sequence) | GGGAGUGCUUCGUGCUUCUG |
| Sanger 성숙/소수 수납 번호 | MIMAT0014826 |
| microRNA 수납 번호 | MI0014022 |
| 배송 상태(Shipping Condition) | Dry Ice |
| 저장 온도(Storage Temperature) | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to effectively inhibit target miRNA activity.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which enables co-transfection with compatible packaging plasmids to produce viral particles suitable for mammalian cell transduction.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
- Puromycin resistance gene for efficient selection of transduced cells
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 포맷으로 다양한 세포 유형에 적용 가능
- 반복적인 트랜스펙션 없이 장기적 억제 유지 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



