Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-664-5p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제. 효율적인 세포 전달 및 장기적 miRNA 억제 가능. TRC2-pLKO-puro 벡터 기반으로 퓨로마이신 선택 마커 포함. −70°C에서 건빙 상태로 배송.
- 카탈로그번호
- MLTUD0972
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-664-5p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for transduction of mammalian cells.
The vector includes the WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과
- 다양한 세포 유형에 효율적인 렌티바이러스 전달
- 반복적인 트랜스펙션 없이 장기적 억제 가능
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CUGGCUGGGGAAAAUGACUGG |
| Sanger 성숙/소수 수납 번호 | MIMAT0017353 |
| microRNA 수납 번호 | MI0012531 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
참고 문헌
Haraguchi, T. et al., and Dr. Hideo Iba, University of Tokyo — Tough Decoy (TuD) design algorithm.
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.