Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 Tough Decoy(TuD) 설계를 기반으로 한 렌티바이러스 전달 시스템입니다. 다양한 세포 유형에서 효율적인 miRNA 억제 가능. 장기간 지속되는 억제 효과와 퓨로마이신 선택 마커 포함. −70°C에서 건빙 상태로 배송.
- 카탈로그번호
- MLTUD0952
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-1969
Tough Decoy (TuD) Design
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AAGAUGGAGACUUUAACAUGGGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0009442 |
| microRNA 수납 번호 | MI0009966 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on Haraguchi et al.'s work.
This algorithm employs the Tough Decoy (TuD) design for effective miRNA inhibition.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 기능 제공
- 다양한 세포 유형에 효율적인 렌티바이러스 전달
- 반복적인 트랜스펙션 없이 장기 억제 가능
- 퓨로마이신 저항성 유전자 포함
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.