
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 디자인 적용. TRC2-pLKO-puro 벡터 사용으로 다양한 세포에 효율적 전달 가능. 푸로마이신 저항성 유전자 포함으로 안정적 선택 가능. 장기적인 miRNA 억제 효과 제공.
- 카탈로그번호
- MLTUD0958
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-1839-3p
Type: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AGACCUACUUAUCUACCAACAGC |
| Sanger 성숙/소수 수납 번호 | MIMAT0009457 |
| microRNA 수납 번호 | MI0009991 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent and specific inhibition of target miRNA.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles capable of transducing mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) enhances transgene expression delivered by lentiviral vectors.
The vector also includes a puromycin resistance gene for stable selection of transduced cells.
주요 특징
- 강력하고 선택적인 miRNA 억제 가능
- 렌티바이러스 전달 포맷으로 다양한 세포 유형에 효율적 적용
- 반복적인 트랜스펙션 없이 장기적인 억제 효과 유지
- WPRE 포함으로 발현 효율 향상
- 푸로마이신 저항성 유전자로 안정적 세포 선택 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



