
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 microRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 인히비터. 효율적인 세포 전달 및 장기적 억제 가능. TRC2-pLKO-puro 벡터 사용, 퓨로마이신 선택 가능. −70°C에서 건빙 상태로 배송.
- 카탈로그번호
- MLTUD0957
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
타깃 microRNA
- mmu-miR-1839-5p
- 형태: Tough Decoy (TuD)
품질 등급
200
제품 라인
MISSION®
형태
liquid
농도
≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
AAGGUAGAUAGAACAGGUCUUG
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
dry ice
저장 온도
−70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids generates viral particles for transduction into mammalian cells.
The vector includes Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 목표 miRNA의 강력한 억제 가능
- 렌티바이러스 전달 포맷으로 다양한 세포에 효율적 전달
- 반복 형질감염 없이 장기적 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



