Merck MISSION Lenti microRNA Inhibitor, Mouse
Tough Decoy(TuD) 디자인 기반의 렌티바이러스 miRNA 억제제. 다양한 세포에 효율적으로 전달 가능. 장기적 miRNA 억제 효과 제공. 퓨로마이신 내성 유전자를 포함하여 선택 가능. −70°C에서 건빙 상태로 배송.
- 카탈로그번호
- MLTUD0953
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-1946b
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi, T. This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles that can transduce mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- Potent inhibition of target miRNA
- Efficient lentiviral delivery into various cell types
- Enables long-term inhibition without repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | GCCGGGCAGUGGUGGCACAUGCUUUU |
| Sanger 성숙/소수 수납 번호 | MIMAT0009443 |
| microRNA 수납 번호 | MI0009967 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.